sgrna in vitro transcription kit (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
95
Structured Review
TaKaRa
sgrna in vitro transcription kit
Sgrna In Vitro Transcription Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 150 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vitro+transcription+kit/Guide-it+sgRNA+In+Vitro+Transcription+Kit/pm40853436-51-43-48
Average 95 stars, based on 150 article reviews
Sgrna In Vitro Transcription Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 150 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vitro+transcription+kit/Guide-it+sgRNA+In+Vitro+Transcription+Kit/pm40853436-51-43-48
Average 95 stars, based on 150 article reviews
sgrna in vitro transcription kit - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
CRISPR:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Knock-Out:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Sequencing:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: Nuclear receptor coregulator NRIP1 R448G modulates T cell gut homing to control intestinal inflammation. Article Snippet: .. The single guide RNA (sgRNA) target sequence (5′- CAGCTTCCGGCTTTTCGATC- 3′) was screened and selected from the mouse Nrip1 genome DNA sequence. sgRNA was in vitro- transcribed and purified by using the Guide- It sgRNA In Article Title: Gene editing of the GJB2 locus in porcine embryos using CRISPR/Cas9 and cytosine base editors: toward a model of congenital deafness. Article Snippet: .. This strategy was selected to produce loss-of-function alleles, mimicking the molecular consequence of the most common human pathogenic variants in GJB2, such as 35delG and 235delC, which also result in truncated, non-functional connexin 26 proteins. sgRNAs were synthesized using the Guide-it TM sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In In Vitro:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: Nuclear receptor coregulator NRIP1 R448G modulates T cell gut homing to control intestinal inflammation. Article Snippet: .. The single guide RNA (sgRNA) target sequence (5′- CAGCTTCCGGCTTTTCGATC- 3′) was screened and selected from the mouse Nrip1 genome DNA sequence. sgRNA was in vitro- transcribed and purified by using the Guide- It sgRNA In Article Title: Gene editing of the GJB2 locus in porcine embryos using CRISPR/Cas9 and cytosine base editors: toward a model of congenital deafness. Article Snippet: .. This strategy was selected to produce loss-of-function alleles, mimicking the molecular consequence of the most common human pathogenic variants in GJB2, such as 35delG and 235delC, which also result in truncated, non-functional connexin 26 proteins. sgRNAs were synthesized using the Guide-it TM sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: Dual knockout of Fas and TCRα in Jurkat reporter cells enables highly sensitive identification of antigen-specific TCRs. Article Snippet: T-cell receptors (TCRs) that target tumor antigens are crucial for antitumor immunity; however, tumor-specific TCRs often exhibit low affinity for their cognate antigens, making the identification of functional TCRs challenging due to the limited sensitivity of current detection methods.. In this study, we established a high-sensitivity TCR screening platform by generating Jurkat cell reporter clones with dual knockout (DKO) of endogenous Fas and TCRα via CRISPR–Cas9 system.. In a viral antigen model system, these DKO Jurkat cells exhibited approximately 100-fold greater sensitivity to antigen stimulation compared with parental Jurkat cells. Article Title: A CRISPR/Cas9-based genome-editing platform enabling efficient and precise gene replacement in Lipomyces starkeyi. Article Snippet: .. In Article Title: GLP-1R R131Q links long-range conformational remodeling to cellular stress phenotypes Article Snippet: Glucagon-like peptide-1 receptor (GLP-1R) agonists show substantial inter-individual variability in efficacy, but the structural basis by which common GLP-1R variants alter receptor behavior remains unclear.. We examined the GLP-1R R131Q variant using all-atom molecular dynamics simulations across four conditions (wild type [WT] and R131Q in ligand-free and GLP-1-bound states; 8–11 replicas per condition; 600 ns each) together with isogenic human induced pluripotent stem cell (iPSC)-derived pancreatic models.. In ligand-free simulations, principal component analysis identified a variant-enriched subensemble associated with coordinated deviations spanning TM1 and the ECL3-side region. Article Title: Mutation in <i>OPR3</i> ortholog affects stamen function but not petal size in <i>Torenia fournieri</i> Article Snippet: .. Cleavage efficacy of the candidate sequences was tested using a Guide-it sgRNA In Clone Assay:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Plasmid Preparation:Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains. Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGTATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Article Title: TfR1 facilitates influenza virus endocytosis and uncoating by interacting with NA and M1 via extracellular and intracellular domains Article Snippet: .. CRISPR-Cas9 knockout: The oligonucleotide sequence is listed as follows: TfR1-sgRNA1: CTGAACCGGGT-ATATGACAA; TfR1-sgRNA2: CAGGAACCGAGTCTCCAGTG; TfR1-sgRNA3: AAATTCATATGTCCCTCGTG. sgRNAs were transcribed and screened with Guide-it sgRNA In Purification:Article Title: Nuclear receptor coregulator NRIP1 R448G modulates T cell gut homing to control intestinal inflammation. Article Snippet: .. The single guide RNA (sgRNA) target sequence (5′- CAGCTTCCGGCTTTTCGATC- 3′) was screened and selected from the mouse Nrip1 genome DNA sequence. sgRNA was in vitro- transcribed and purified by using the Guide- It sgRNA In Synthesized:Article Title: Gene editing of the GJB2 locus in porcine embryos using CRISPR/Cas9 and cytosine base editors: toward a model of congenital deafness. Article Snippet: .. This strategy was selected to produce loss-of-function alleles, mimicking the molecular consequence of the most common human pathogenic variants in GJB2, such as 35delG and 235delC, which also result in truncated, non-functional connexin 26 proteins. sgRNAs were synthesized using the Guide-it TM sgRNA In Article Title: Dual knockout of Fas and TCRα in Jurkat reporter cells enables highly sensitive identification of antigen-specific TCRs. Article Snippet: T-cell receptors (TCRs) that target tumor antigens are crucial for antitumor immunity; however, tumor-specific TCRs often exhibit low affinity for their cognate antigens, making the identification of functional TCRs challenging due to the limited sensitivity of current detection methods.. In this study, we established a high-sensitivity TCR screening platform by generating Jurkat cell reporter clones with dual knockout (DKO) of endogenous Fas and TCRα via CRISPR–Cas9 system.. In a viral antigen model system, these DKO Jurkat cells exhibited approximately 100-fold greater sensitivity to antigen stimulation compared with parental Jurkat cells. Article Title: GLP-1R R131Q links long-range conformational remodeling to cellular stress phenotypes Article Snippet: Glucagon-like peptide-1 receptor (GLP-1R) agonists show substantial inter-individual variability in efficacy, but the structural basis by which common GLP-1R variants alter receptor behavior remains unclear.. We examined the GLP-1R R131Q variant using all-atom molecular dynamics simulations across four conditions (wild type [WT] and R131Q in ligand-free and GLP-1-bound states; 8–11 replicas per condition; 600 ns each) together with isogenic human induced pluripotent stem cell (iPSC)-derived pancreatic models.. In ligand-free simulations, principal component analysis identified a variant-enriched subensemble associated with coordinated deviations spanning TM1 and the ECL3-side region. Modification:Article Title: Dual knockout of Fas and TCRα in Jurkat reporter cells enables highly sensitive identification of antigen-specific TCRs. Article Snippet: T-cell receptors (TCRs) that target tumor antigens are crucial for antitumor immunity; however, tumor-specific TCRs often exhibit low affinity for their cognate antigens, making the identification of functional TCRs challenging due to the limited sensitivity of current detection methods.. In this study, we established a high-sensitivity TCR screening platform by generating Jurkat cell reporter clones with dual knockout (DKO) of endogenous Fas and TCRα via CRISPR–Cas9 system.. In a viral antigen model system, these DKO Jurkat cells exhibited approximately 100-fold greater sensitivity to antigen stimulation compared with parental Jurkat cells. Control:Article Title: GLP-1R R131Q links long-range conformational remodeling to cellular stress phenotypes Article Snippet: Glucagon-like peptide-1 receptor (GLP-1R) agonists show substantial inter-individual variability in efficacy, but the structural basis by which common GLP-1R variants alter receptor behavior remains unclear.. We examined the GLP-1R R131Q variant using all-atom molecular dynamics simulations across four conditions (wild type [WT] and R131Q in ligand-free and GLP-1-bound states; 8–11 replicas per condition; 600 ns each) together with isogenic human induced pluripotent stem cell (iPSC)-derived pancreatic models.. In ligand-free simulations, principal component analysis identified a variant-enriched subensemble associated with coordinated deviations spanning TM1 and the ECL3-side region. |